Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride

wusahaningtyas, lulu and Nuryady, Moh. and nurcahyo, wisnu Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride. Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride: 41. pp. 1-6.

[thumbnail of Wusahaningtyas Nuryady Firdausy Nurcahyo - ABC2 Transporter Gene Trypanosoma evansi Isometamidium Chloride Resistance.pdf]
Preview
Text
Wusahaningtyas Nuryady Firdausy Nurcahyo - ABC2 Transporter Gene Trypanosoma evansi Isometamidium Chloride Resistance.pdf

Download (572kB) | Preview
[thumbnail of Similarity - Wusahaningtyas Nuryady Firdausy Nurcahyo - ABC2 Transporter Gene Trypanosoma evansi Isometamidium Chloride Resistance.pdf]
Preview
Text
Similarity - Wusahaningtyas Nuryady Firdausy Nurcahyo - ABC2 Transporter Gene Trypanosoma evansi Isometamidium Chloride Resistance.pdf

Download (1MB) | Preview

Abstract

This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma
evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used
blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW,
ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted
and amplified using primers. ABC2 F 5 'GCTTGTCCGACCATCTTGCA 3' and ABC2 R 5
'AGGTCCACTCCCATGCTACA 3' that produced 350 basepairs (bp). The sequencing results were then
analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple
alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was
exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation.
The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei
gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2
Transporter gene is needed.

Item Type: Article
Keywords: ABC2 Transporter Gene, Trypanosoma evansi, Isometamidium Chloride, resistance
Subjects: Q Science > QL Zoology
Divisions: Faculty of Teacher Training and Education > Department of Biology Education (84205)
Depositing User: mirzanuryady Moh. Mirza Nuryady, S.Si., M.Sc
Date Deposited: 09 Mar 2024 04:27
Last Modified: 09 Mar 2024 04:27
URI: https://eprints.umm.ac.id/id/eprint/4615

Actions (login required)

View Item
View Item